مقالات

بررسی شیوع لاکتوباسیل‌های واژینال در زنان ایرانی به روش تشخیص ژنتیکی

دکتر الهه متوسلی،مهدیه شیرزاد،دکتر سید محمد هاشمی نسب،دکتر محمد حسین مدرسی  ۱۳۹۱/۰۵/۰۳
  فایلهای مرتبط
زمینه و هدف: فلور طبیعی واژن و گردن رحم به طور غالب از باکتری‌هایی به نام لاکتوباسیل‌ها تشکیل شده است. لاکتوباسیل‌ها جزء میکروارگانیسم‌های پروبیوتیک محسوب می‌شوند و دریافت میزان مناسب آن‌ها برای بدن انسان سودمند می‌باشد. محصولات لاکتوباسیل‌ها از جمله اسید لاکتیک، پراکسید هیدروژن و باکتریوسین‌ها از طریق مهار کلونیزاسیون پاتوژن‌ها موجب تثبیت فلور طبیعی واژن می‌شوند. تشخیص نوع لاکتوباسیل‌های موجود در واژن زنان سالم و استفاده مناسب از آن‌ها به صورت خوراکی و یا واژینال می‌تواند راه مناسبی جهت جلوگیری از عفونت واژینال و حتی سرطان واژن و گردن رحم در بانوان باشد. با توجه به این‌که نوع لاکتوباسیل‌های واژینال در کشورهای مختلف متفاوت است و روش‌های مرسوم و متداول در تشخیص لاکتوباسیل‌ها در کشور ما دارای محدودیت‌های فراوانی است، در این مطالعه لاکتوباسیل‌های فلور طبیعی واژینال بانوان ایرانی برای اولین بار به روش تشخیص مولکولی و ژنتیکی مورد بررسی قرار گرفته است.

زمینه و هدف


هر منطقه از بدن انسان دارای مجموعه‌ای منحصر به فرد  از میکروارگانیسم‌ها است. اگرچه در گذشته بیش‌تر تمایل داشتند که با مشخص کردن عامل اتیولوژیک بیماری‌های عفونی سلامتی انسان را حفظ کنند و موجب جلوگیری از ابتلا به بیماری شوند، اخیرا مشخص شده است که میکروارگانیسم‌های بومی و در واقع، رابطه دو طرفه بین آن‌ها و میزبان انسانی نقش مهم‌تری در حفظ سلامتی و بهداشت انسان دارد. در این رابطه همزیستی، انسان به عنوان یک میزبان، فشار انتخابی قوی بر تعیین نوع میکروارگانیسم‌ها در مناطق مختلف بدن اعمال می‌کند و در مقابل، میکروارگانیسم‌های انتخاب شده موجب حفظ فیزیولوژی طبیعی انسان می‌شوند. عملکردهای این میکروارگانیسم‌ها بسیار متنوع می‌باشد که از جمله آن‌ها: حفظ تعادل سیستم ایمنی بدن و فعالیت‌های  متابولیک، کاهش خطر ابتلا به سرطان و کمک به فعالیت‌های گوارشی و جلوگیری از دیابت و چاقی می‌باشد. از این رو، مشخص کردن طیف و نوع میکروارگانیسم‌های بومی انسانی و درک عملکرد اکولوژیک آن‌ها، موجب درک بهتر علت تفاوت ریسک خطر ابتلا به بیماری در افراد متفاوت و در نهایت پیشگیری و درمان بیماری‌ها می‌شود.1 فلور واژن انسان شامل مجموعه میکروبی پویا و پیچیده‌ای است که در آن همزیستی میکروارگانیسم‌های مختلف موجب حفظ سلامت فرد می‌شود. در مطالعات متعدد مشخص شده که لاکتوباسیل‌ها باکتری غالب در محیط واژن زنان سالم هستند. لاکتوباسیل‌ها عضو اصلی گروه پروبیوتیک‌ها هستند. پروبیوتیک‌ها باکتری‌هایی هستند که مصرف میزان مناسب آن‌ها موجب حفظ سلامتی انسان می‌شود. در واژن زنان سالم، لاکتوباسیل‌ها گلیکوژن تولید شده توسط سلول‌های مخاط واژن را به گلوکز و سپس به اسید لاکتیک تبدیل می‌‌کنند و اسید لاکتیک تولید شده با اسیدی کردن محیط واژن سد دفاعی قابل توجهی جهت جلوگیری از رشد باکتری‌های پاتوژن ایجاد می‌‌کند. برخی از لاکتوباسیل‌ها نیز علاوه بر اسید لاکتیک، ماده ضدعفونی ‌کننده طبیعی دیگری به نام پراکسید هیدروژن تولید می‌کنند که سبب تقویت مضاعف دفاع واژن می ‌شود. هر گونه اخلال در میزان لاکتوباسیل‌های واژینال و یا ترکیب آن‌ها می‌تواند منجر به عفونت‌های مختلف ادراری تناسلی از جمله واژینوز باکتریال، بیماری‌های مقاربتی و یا ابتلا به ایدز شود. واژینوز باکتریال نوعی عفونت واژینال است که در آن فلور طبیعی واژن مختل شده و تعداد لاکتوباسیل‌های طبیعی در اثر افزایش بیش از حد باکتری‌های بی‌هوازی مختلف کاهش می‌یابد. این بیماری در زنان در سن باروری شایع بوده و ممکن است با ترشحات واژینال بدبو همراه باشد، اگرچه در بسیاری از زنان نیز بدون علامت است. اگرچه این بیماری موجب نازایی زنان می‌شود، در افراد باردار نیز می‌تواند موجب اختلالات پری‌ناتال از جمله تولد زودرس نوزاد و کوریوآمنیونیت شود که این بیماری‌ها ارتباط نزدیکی با مرگ و میر و معلولیت‌های نوزادان در سراسر جهان دارند. امروزه درمان‌های دارویی واژینوز باکتریال در بازگرداندن فلور طبیعی واژن موفق نبوده‌اند و علاوه بر ایجاد عوارض جانبی موجب ظهور سویه‌های مقاوم در برابر دارو و یا عود بیماری شده‌اند. با توجه به این مطلب، راهکار پیشنهادی بعدی استفاده از محصولات پروبیوتیک حاوی لاکتوباسیل‌ها به عنوان جایگزینی مناسب جهت پیشگیری و درمان عفونت‌های ادراری تناسلی است چرا که این روش درمانی همراه با حفظ تعادل فلور طبیعی ادراری تناسلی و حفظ توانایی باروری زنان می‌باشد. به تازگی، مطالعات متعدد طیف میکروبی فلور واژن را در کشورهای مختلف با استفاده از روش‌های متفاوت بررسی کرده‌اند. در اغلب این مطالعات یک فرضیه اصلی مورد بررسی قرار گرفته است و این فرضیه این است که آیا تفاوت در ترکیب گونه‌های باکتریایی واژن جوامع مختلف می‌تواند موجب مستعد شدن برخی افراد به واژینوز باکتریال و یا بیماری‌های عفونی و یا غیر عفونی از جمله سرطان شود. پیش از این، انواع مختلفی از میکروب‌های واژینال در زنان سالم جوامع مختلف گزارش شده‌اند و مشخص شده که طیف و نوع آن‌ها در مناطق مختلف تفاوت قابل توجهی دارند. با توجه به این‌که تاکنون چنین بررسی در کشور ما انجام نشده بود، ما در این مطالعه لاکتوباسیل‌های واژینال زنان سالم ایرانی را مشخص کرده و انواع آن‌ها را با فلور طبیعی زنان سالمی که از نژادها و کشورهای دیگر مورد مطالعه قرار گرفته بودند مورد مقایسه قرار دادیم تا تعیین کنیم که آیا طیف باکتری‌های واژینال زنان ایرانی با دیگر نژادها متفاوت هستند یا خیر. در کشور ما روش‌های متعارف تشخیص باکتری‌ها بر پایه تشخیص بیوشیمیایی هستند که محدودیت‌های فراوانی دارند. این محدودیت‌ها شامل ضرورت انجام چندین مرحله آزمایش، نیاز به وسایل خاص و مواد گران‌قیمت، نیاز به مهارت و دقت بالای فرد آزمایش کننده و زمان طولانی لازم برای انجام برخی آزمایشات تشخیصی و در نهایت ابهام آمیز بودن پاسخ برخی آزمایش‌ها می‌باشند. به طور مثال آزمایشات قندی که برای تشخیص گونه لاکتوباسیل‌ها انجام می‌شود نیاز به چندین نوع قند دارد که گران قیمت و وارداتی هستند و حداقل یک هفته وقت لازم است تا آزمایش تکمیل شود و البته بعد از اتمام مراحل بیوشمیایی باز هم تشخیص قطعی نخواهد بود. از این‌رو، امروزه با توجه به محدودیت‌ها و مشکلات روش‌های بیوشیمیایی، در اغلب کشورها روش‌های مولکولی مناسب‌تر و دقیق‌تر جایگزین روش‌های قبلی شده‌اند. روش‌های مولکولار ژنتیکی که برای تشخیص لاکتوباسیل‌ها مورد استفاده قرار می‌گیرند متعدد هستند اما در کشور ما هنوز این روش‌ها به صورت محدود مورد استفاده قرار می‌گیرند و نمی‌توانند به سرعت و در یک مخلوط باکتریایی انواع لاکتوباسیل‌ها را مشخص کنند. در این راستا، در این مطالعه تلاش شد که با بررسی دقیق‌تر ژنوم باکتری‌ها، روش مولکولی دقیق‌تر و ارزان‌تری جهت تشخیص لاکتوباسیل‌های واژینال طراحی شده و باکتری‌های واژینال زنان ایرانی مشخص شود.

روش بررسی

تشخیص ژنتیکی: DNA نمونه مخلوط توسط کیت DNG plus شرکت سیناژن خالص سازی شده و سپس به روشMultiplex PCR  و بدون نیاز به جداسازی گونه‌ها و با استفاده از پرایمرهای اختصاصی، گونه لاکتوباسیل‌های واژینال مشخص شد.

نمونه‌گیری: نمونه‌گیری توسط سواب استریل از ناحیه اگزوسرویکس و واژن زنان سالم مراجعه‌کننده به درمانگاه بیماران سرپایی زنان بیمارستان امام‌خمینی و چند مطب خصوصی جمع‌آوری شد. زنان سالم افرادی در نظر گرفته می‌شدند که هیچ شکایتی از عفونت نداشتند و در معاینه نیز علایم عفونت واژینال نداشتند ضمنا برای تمام نمونه‌ها رنگ‌آمیزی گرم انجام شد و بر اساس درجه‌بندی Nugent سالم بودن نمونه‌ها تایید و موارد غیر سالم از مطالعه حذف شد.

بررسی آماری: پس از مشخص شدن نوع لاکتوباسیل‌ها توسط نرم‌افزار SPSS بررسی آماری انجام شد.

 

یافته‌ها

ترکیب اصلی لاکتوباسیلوس‌های نمونه‌های سواب 100 زن سالم در سنین باروری مورد مطالعه قرار گرفت و نتایج در جدول 1 ارایه شده است:


جدول- 1: پرایمرهای اختصاصی لاکتوباسیل‌ها

Reverse primer

Forward primer

Lactobacillus

CCTTTCCCTCACGGTACTG

TGCAAAGT GGTAGCGTAAGC

L. acidophilus

CCTTTCCCTCACGGTACTG

AAGAAGGCACTGAGTACGGA

L. jensenii

CAACTATCTCTCTTACACTGCC

AGGATATGGAGAGCAGGAAT

L. crispatus

TGCTATCGCTTCAAGTGCTT

AGCGACCGAGAAGAGAGAGA

L. gasseri

GGCCAGCTATGTATTCACTGA

CTAGCGGGTGCGACTTTGTT

L. paracasei

GCGATGCGAATTTCTATTATT

CTAGCGGGTGCGACTTTGTT

L. rhamnosus

CACTCTCTTTGGCTAATCTT

AATCGCTAAACTCATAACCT

L. salivarius

GCTTGTTGGTTTGGGCTCTTC

CAGACAATCTTTGATTGTTTAG

L. reuteri

CCTGAACTGAGAGAATTTGA

ATTCATAGTCTAGTTGGAGGT

L. plantarum

TTCACTGCTCAAGTAATCATC

ACTAACTTGACTGATCTACGA

L. fermentum

ATCTAATCTCTTAGACTGGCTATG

ACAGGGGTAGTAACTGACCTTTG

L.iners

 


جدول- 2: درصد لاکتوباسیل‌های شایع در زنان سالم ایرانی

percents

lactobacillus

30

Acidophilus

30

jensenni

30

gasseri

67

crispatus

30

rhamnosus

20

paracasei

50

iners

 

 

 

 

 

 

 

 

 

 

 

 

 


شکل- 1: تصویر نتیجه یک PCR اختصاصی

 

بحث و نتیجه‌گیری

در بررسی‌های انجام شده در کشورهای مختلف، انواع لاکتوباسیل‌های موجود در فلور طبیعی واژن زنان تفاوت‌های مشخصی دارند. نتایج مطالعه ما نیز با نتایج به دست آمده از زنان دیگر کشورها و نژادها تفاوت‌ها و شباهت‌های جالب توجهی دارد. در حدود 15 سال پیش طیف میکروبی شایع شاملL. acidophilus and L. fermentum, followed by L. brevis, L. jensenii, L. casei, بود اما استفاده از روش‌های مولکولی در سال‌های اخیر، L. crispatus, L. iners, and L. jensenii را به عنوان انواع شایع معرفی کرده‌اند2 و نتایج ما با نتایج سال‌های اخیر شباهت مشخصی دارد. در سال 2007 مطالعه‌ای در کشور بلژیک انجام شده که انواع لاکتوباسیل‌های شایع را L.iners L.acidophilus, L.gasseri, L.vaginalis, ذکر کرده‌اند.3

در مطالعه‌ای دیگر در سال 2009 در کشور هند L.reuteri, L.fermentum, L.salvaricus, L.plantarum شایع‌تر گزارش شده‌اند که با نتایج دیگران تفاوت واضحی دارد.4 در مطالعه‌ای دیگر در سال 2010 در کشور ژاپن لاکتوباسیل‌های شایع L.iners, L.crispatus, L.jensenni, L.gasseri ذکر شده‌اند1 و این گونه‌ها مشابه نتایج به دست آمده از بررسی زنان سفید پوست و سیاه‌پوست امریکای شمالی است.5 البته در مطالعاتی که این چهار گونه ذکر شده‌اند هم درصد آن‌ها متفاوت                     ذکر شده است، به طور مثال در کشور چین این درصدها به          این ترتیب هستند: (68%) L.iners  (43%) L.jensenii (85%)L.gasseri، (94%) L.crispatus 6 و در زنان سالم باردار کشور ژاپن بدین ترتیب: (8/39%) L.iners (7/33%) L.gasseri (6/29%) L.gensenii (2/61%) L.crispatus7

 

تمام این شواهد نشان‌دهنده این است که تفاوت‌ها و شباهت‌های جالب توجهی میان گونه‌های لاکتوباسیلی شایع در جوامع مختلف وجود دارد و در هر نژاد با توجه به داشتن شرایط ژنتیکی و محیطی خاص، میکروارگانیسم‌های مشخصی توانایی رقابت و کلونیزاسیون در محیط واژن را دارند. با توجه به این که شواهد متعددی مبنی بر نقش حیاتی لاکتوباسیل‌ها در ارتقا سلامت و بهداشت فردی از طریق جلوگیری از ابتلا به بیماری‌های عفونی و غیر عفونی ازجمله سرطان وجود دارد، مشخص شدن نوع لاکتوباسیل‌های بومی در کشور ما می‌تواند در انتخاب نوع مناسب لاکتوباسیل جهت مصرف پروبیوتیکی نقش موثری داشته باشد.



Abstract:

 

Vaginal lactobacilli determination in Iranian population by molecular analysis

Motevaseli E. M.D., Ph.D.*, Shirzad M. M.Sc.*, Hasheminasb S. M. M.D.*, Modarressi M. H. M.D., Ph.D.*

Introduction & Objective: The healthy human vaginal and cervical ecosystem is dominated by Lactobacillus species. Lactobacilli represent sources of beneficial organisms termed probiotics. Probiotics are defined as live micro-organisms which confer a health benefit on the host when administered in adequate amounts. Lactobacilli metabolic products, such as hydrogen peroxide (H2O2), lactic acid, and bacteriocins are believed to play an important role in maintenance of the normal vaginal flora by inhibiting colonization of other pathogens. In this study we examined the prevalence of vaginal lactobacilli in healthy women by molecular analysis. The determination of the most common lactobacilli in healthy women would be important to specify the appropriate one to be used as a probiotic.

Key Words: Vaginal lactobacilli, probiotics, Multiplex PCR.

*Medical Genetics Department, Tehran University of Medical Sciences, Tehran, Iran.

 

 


 


References:

 


1. Zhou, X., M.A. Hansmann, C.C. Davis, et al., The vaginal bacterial communities of Japanese women resemble those of women in other racial groups. FEMS Immunol Med Microbiol, 2010. 58(19912342): p. 169-181.

2. Nam, H., K. Whang and Y. Lee, Analysis of vaginal lactic acid producing bacteria in healthy women. J Microbiol, 2007. 45(18176534): p. 515-520.

3. Vitali, B., C. Pugliese, E. Biagi, et al., Dynamics of vaginal bacterial communities in women developing bacterial vaginosis, candidiasis, or no infection, analyzed by PCR-denaturing gradient gel electrophoresis and real-time PCR. Appl Environ Microbiol, 2007. 73(17644631): p. 5731-5741.

4. Garg, K.B., I. Ganguli, R. Das, et al., Spectrum of Lactobacillus species present in healthy vagina of Indian women. Indian J Med Res, 2009. 129(19692744): p. 652-657.

5. Zhou, X., C.J. Brown, Z. Abdo, et al., Differences in the composition of vaginal microbial communities found in healthy Caucasian and black women. ISME J, 2007. 1(18043622): p. 121-133.

6. Yan, D.-h., Z. Lu and J.-r. Su, Comparison of main lactobacillus species between healthy women and women with bacterial vaginosis. Chin Med J (Engl), 2009. 122(19951608): p. 2748-2751.

7. Tamrakar, R., T. Yamada, I. Furuta, et al., Association between Lactobacillus species and bacterial vaginosis-related bacteria, and bacterial vaginosis scores in pregnant Japanese women. BMC Infect Dis, 2007. 7(17986357): p. 128-128.


 


 

 

 

 


برای نظر دادن ابتدا باید به سیستم وارد شوید. برای ورود به سیستم اینجا کلیک کنید.